Insect collection

Gonatocerus morrilli were collected from H. coagulata egg masses. Two populations were collected five months apart in 2003 from Orange (OrCo) and San Diego (SDCo) counties of California and two were from Hidalgo county, Texas (Weslaco; Wes-2 and Wes-3). Sharpshooter egg masses laid in citrus leaves were retrieved from the field. Five individuals from Wes-2 were an F1-generation. The leaves were washed with 5% bleach then incubated at 28 °C, 16:8 L:D scotophase on damp filter papers in Petri dishes. Wasps were collected daily and stored at −80 °C in 95% ethanol prior to analysis.

Genomic DNA isolation

Genomic DNA was extracted according to standard methods (Sambrook and Russell 2001). Individual wasps were homogenized on ice in 1.5 ml microfuge tubes in 60 µl of lysis buffer (10 mM Tris-HCl [pH 7.5], 1 mM EDTA [pH 8.0], 1% IGEPAL CA-630]) using two 20 second grindings with 10 min intervals on ice (Pellet Pestle Motor, Bel-Art Products, Pequannock, New Jersey). To avoid cross contamination between samples, a sterile plastic pestle was used for each insect. The final DNA pellet was resuspended in 61 µl of TE (Tris-HCl [pH 7.5], 1 mM EDTA [pH 7.5]). To confirm for the present of genomic DNA, amplification reactions were performed with 1 µl of stock DNA and 28S primers at an annealing temperature of 65 °C (forward CCCTGTTGAGCTTGACTCTAGTCTGGC and reverse AAGAGCCGACATCGAAGGATC) with 1.5 mM MgCl₂ and the amplification conditions described below.

ISSR–PCR DNA fingerprinting

ISSR–PCR amplification reactions are described in de León and Jones (2004). The reactions were performed with the 5′-anchored primer HVH(TG)₇T (Zietkiewicz et al. 1994). Notations: H = A/T/C, and V = G/C/A. The reactions were performed in a final volume of 20 µl with the following components: 1X PCR buffer [50 mM KCl, 20 mM Tris-HCl (pH 8.4), 1.5 mM MgCl₂, and 0.01% gelatin], 0.25 mM deoxynucleotide triphosphates, 0.25 mM ISSR primer, 1.0 µl of stock genomic DNA and 0.05 U/µl Taq DNA Polymerase (New England Biolabs, Beverly, Massachusetts). The cycling parameters were as follows: 1 cycle at 94 °C for 2 min followed by 45 cycles at 94 °C for 1 min, 56 °C for 1 min, and 72 °C for 2 min. Reactions were optimized for amount of genomic DNA, annealing temperature, MgCl₂ concentration, and cycle number. Negative control reactions were performed in the absence of genomic DNA. Amplification products were loaded onto 2% agarose gels and submitted to electrophoresis in 1X TBE buffer (90 mM Tris-borate, 2 mM EDTA) in the presence of 0.2 µg/ml ethidium bromide. Gels were photographed with the Chemi Doc System and markers/bands were scored via the Quantity One Software (Bio-Rad Laboratories, Hercules, California).

Internal transcribed spacer amplification, ITS-1 and -2

For ITS-1 amplification, the following primers were used: ITS5, GGAAGTAAAAGTCGTAACAAGG and RNA2, CACGAGCCGAGTGATCCACCGCTAAGAGT (White et al. 1990) and for ITS-2, 5.8S-F, TGTGAACTGCAGGACACATGAAC and 28S-R, ATGCTTAAATTTAGGGGGTA (Porter and Collins 1991) were used. The amplification reactions were performed as with ISSR–PCR above. The MgCl₂ concentration for the ITS-1 reaction was increased to 2.0 mM. The cycling parameters were as follows: 1 cycle for 3 min at 94 °C followed by 45 cycles at 94 °C for 20 s, 55 °C (ITS-1) or 45 °C (ITS-2) for 20 s, and 72 °C for 60 s.

Data analysis

Bands observed in each lane were compared with all the other lanes of the same gel and reproducible bands scored as presence (1) or absence (0). ISSR–PCR markers are treated as dominant markers (reviewed in Wolfe and Liston 1998). Fragment sizes were estimated based on the 1.0 Kb Plus DNA Ladder (Invitrogen Life Technologies, Carlsbad, California) according to the algorithm provided in the Quantity One software. Genetic variation was analyzed using the POPGENE 3.2 genetic software program (Yen et al. 1996). The program estimates polymorphic loci, percentage polymporhic loci, gene diversity (h), total genetic diversity (Ht), average genetic diversity within populations (Hs) (Nei 1973, 1977, 1978), coefficient of gene differentiation (G_ST) (Nei 1987), and gene flow (Slatkin and Barton 1989). Dendrograms based on Nei's (1987) and Reynolds et al. (1983) genetic distances and the unweighed pair-group method with arithmetic averages (UPGMA) of Sneath and Sokal (1973) were constructed with the program Tools for Population Genetic Analysis (TFPGA, ver. 1.3, Miller 1997). Marker frequencies were estimated based on Lynch and Milligan's (1994) Taylor expansion estimate. Bootstrapping over loci was also performed with TFPGA with 1000 permutations by the algorithm of Felsenstein (1985). Exact tests (χ²) for population differentiation (simultaneous analyses of all populations) were calculated with the TFPGA program by the method of Raymond and Rousset (1995), where a Markov Chain Monte Carlo approach was employed that gives an excellent approximation of the exact probability of the observed differences in marker frequencies. The exact tests, which included Lynch and Milligan's (1994) Taylor correction factor, were performed with 1000 dememorization steps, 20 batches, and 2000 permutations per batch. Fisher's combined probability tests (Fisher 1954; Manly 1991; Sokal and Rohlf 1995) were employed as a global test over loci to determine the overall significance. F-statistics (Weir and Cockerham 1984) were calculated with TFPGA and reported using the terminology of Weir (1990, 1996) where theta (θ) corresponds to F_ST. For dominant markers, estimates of θ by TFPGA were constructed under the assumption of Hardy-Weinberg proportions. Jackknifing/bootstrapping over loci with 5000 replications included Lynch and Milligan's (1994) Taylor expansion estimate. The pseudorandom numbers used in bootstrapping were produced by L'ecuyer's (1988) combined MLCG algorithm.

ISSR–PCR DNA fingerprinting

Figure 1 shows an example of ISSR–PCR DNA fingerprinting demonstrating the banding pattern differences between the geographic populations of G. morrilli from California (OrCo) and Texas (Wes-2) performed with a 5′-anchored ISSR primer. Markers ranged in size from about 200 to 900 base pairs. Overall, a total of 25 markers were generated among all four populations with a total of 40 individuals. Twenty-three were polymorphic and the percentage of polymorphic loci was 92%. Within individual populations, no diversity was seen within the California populations and some diversity was observed in the Texas populations. For the Texas populations, Wes-2 and Wes-3, 5 polymorphic markers each were generated and 20% of the markers were polymorphic. Most markers are geographic-specific and can therefore be considered diagnostic since there was no band sharing between the Texas and California populations.

ISSR–PCR differentiation among four G. morrilli populations

Exact tests (simultaneous analysis) for population differentiation indicated that highly significant differences in marker frequencies existed among the G. morrilli populations (χ² = 400.8; df = 50; P = 0.0000) (Table 1). Total genetic diversity (Ht) was high (0.35 or 35.0%), whereas average genetic diversity within populations was low (0.03 or 3.0%). Table 1 also shows a comparison of other genetic differentiation estimates, G_ST (coefficient of gene differentiation) and θ (theta, analogous to F_ST), which evaluate the degree of genetic subdivision among populations. Excellent agreement was seen between G_ST and θ values, 0.92 and 0.94, respectively. Theses values indicate that about 92 to 94% of the variance is distributed among populations. The indirect estimate of gene flow, Nm base on G_ST, demonstrated a low value (0.04) among the geographic populations; this value indicates highly restrictive gene flow. Overall, genetic differentiation measurements (exact tests, G_ST, θ, and Nm) indicate profound genetic divergence/structuring between G. morrilli populations from Texas and California.

Genetic relatedness among G. morrilli populations

Levels of genetic divergence among populations were also determined by calculating pairwise estimates for genetic distance by the procedures of Nei (1978) and Reynolds et al. (1983) (Table 2). Average genetic divergence (D) among populations was extremely high [Nei = 0.82 (0.89–1.07) and Reynolds = 2.79 (1.4–3.4)]. A dendrogram based on Nei's genetic distance is shown on Figure 2 with all G. morrilli geographic populations. Two clades are identified on the dendrogram with the California and Texas populations appearing on separate clusters. These two clusters are supported by strong bootstrap support values, 68 and 64%, respectively, for the California and Texas populations.

Amplification of the ITS-1 and -2 regions in G. morrilli geographic populations

Monomorphic patterns were demonstrated with amplification of the ITS-1 region in all of the populations from California and Texas (∼850 bp) (Figure 3); whereas, polymorphic or different DNA fragment sizes were detected within the ITS-2 region. The California populations were observed with an ITS-2 fragment size of about 865 base pairs and the Texas populations with a size of about 1099 base pairs.

Good agreement is seen between the two molecular methods and they both suggest that cryptic species may exist. The results with ISSR–PCR, demonstrating distinct banding patterns (no band sharing) between geographic populations, is not typically found unless the populations are reproductively isolated. Similar results were obtained by Hoy et al. (2000) with two populations of Ageniaspis citrocola using RAPD–PCR. The following genetic differentiation parameters, extract test, G_ST, θ, genetic distances, and gene flow (Nm) lend support to this observation. The extremely low value for gene flow between the populations from California and Texas lend support that these populations are isolated reproductively. Restricted gene flow usually leads to increased differentiation among populations as seen from the G_ST and θ values (92 to 94% of the variance is seen among populations). In addition, the divergence (D) between these populations is also high.

Methods incorporating SSR appear to be sensitive at detecting DNA polymorphisms in natural populations. Previously, we utilized ISSR–PCR to distinguish three species of Homalodisca sharpshooters (H. coagulata, H. liturata, and H. insolita) (de León and Jones 2004). Even though this method is sensitive, there are not many reports in the literature utilizing ISSR–PCR to study insect population genetics and phylogenetics. We have also had success determining the population genetic structure of H. coagulata representing 19 populations from through the U.S. (de León et al. 2004). Several investigators have used the ISSR–PCR method successfully with different organisms. For example, the method has been utilized for genetic characterization of the silkworm moth, Bombyx mori (Reddy et al. 1999), for genetic variability studies of Biomphalaria straminea snail complexes (Caldeira et al. 2001), and in many plant studies (reviewed by Wolfe and Liston 1998).

The internal transcribed spacer regions (ITS-1 and -2) have been used extensively to examine the taxonomic status of species and for diagnostic purposes, as reviewed by Collins and Paskewitz (1996). Species-diagnostic differences in sibling species of mosquitoes of the genus Anopheles were determined by Porter and Collins (1991). Zhu and Greenstone (1999) utilized the ITS-2 region to distinguish species and strains of the hymenopterous parasitoid Aphelinus. The size of the ITS-1 fragment between the California and Texas G. morrilli populations did not vary, whereas the ITS-2 fragment did vary in size.

These novel observations strongly suggest that G. morrilli may exist in nature as a species-complex. Results from our recent study with H. coagulata suggest that a subset of these insects have their origin in Texas (de León et al. 2004). Those results together with our present results with G. morrilli suggest that this egg parasitoid from Texas may be a good candidate for the biological control efforts in California against H. coagulata, the causative agent of Pierce's disease. More research is required to confirm these results. Hybridization studies along with sequencing of standard genes [e.g., mitochrondrial cytochrome oxidases (COI and II)] and ITS fragments are in progress.