Samples

Bees were reared at the apiary of Shanxi Agriculture University, Shanxi, China. The thorax and the antennae of adult worker bees were collected for separate PCR analyses of the corresponding DNA and RNA sequences. Tissues obtained from different stages, larval (6 whole bodies), pupal (6 heads), and adult (30 pairs of antennae), were dissected and used directly in isolating the total RNA for the expression profiling of worker bees at different ages.

DNA and RNA extraction

Total DNA was extracted from the thorax of each individual using a modified method described by Smith and Hagen (1996). Total RNA was isolated from 50 antennae of adult worker bees using Trizol reagent (Invitrogen,  www.invitrogen.com), and stored at -70° C until they were used.

Genome internal amplification

cDNA was synthesized from the total RNA isolated from the antennae using a PrimerScript RT reagent Kit (TaKaRa,  www.takarabio.com). Specific primers were designed based on the sequences closely related to the gene AmelOr2 (DQ449670) for AcerOr2 DNA and cDNA amplification. DNA primers were: Forwardl: 5′ TCACCATGCTCTTCTTCACG- 3′-, Reversel: 5′ - CGCTGAATTCCATCAAAGGC- 3′; and F2: 5′ TGCTCGTGGCTCCTGTTCGC- 3′, R2: 5′ - AGCAGTTGGCCGGAAGGTGG- 3′. Samples were subjected to pre-denaturation for 4 min at 94° C first, then 30 cycles of amplification were performed at 94° C for 30 sec, 55° C for 32 sec, and 72° C for 1 min, followed by incubation at 72° C for 8 min. The cDNA primers were: F: 5′ AAGACGTGGACGATCTCACC- 3′ and R: 5′ -GCTACACCATAGGCGTCTCC- 3′). PCR reactions were performed as follows: after 3 min at 94° C, 35 cycles for 30 sec at 94° C, 1 min at 56° C and 1 min at 72° C, then an 8 min elongation at 72° C. PCR products were analyzed by 1.5% agarose gel electrophoresis.

Rapid amplification of cDNA ends (RACE) amplification

cDNAs were synthesized using the SMART RACE cDNA amplification kit (Clontech,  www.clontech.com) for the 3′ and 5′ RACE. The 3′ and 5′ regions of the cDNAs were obtained using 3′ and 5′ RACE-PCRs following the manufacturer's instructions. Gene-specific primers (GSPs) were designed based on the sequence of internal PCR products. 5′ 'RACE GSP: 5′ CCCTCCAGCTCCTCGCAGAGTCATGCC G- 3′; 3′ RACE GSP: 5′ GCCAATGGTATGATGGCTCCGAGGAAG CC- 3′. Amplification reactions were carried out as follows: 94° C for 3 min; then 33 cycles at 94° C for 30 sec, 58∼60° C for 40 sec, and 72° C for 1 min, and 72° C for 6 min.

Cloning and sequencing

The PCR products were cloned and sequenced in Huada Gene Research Center (Beijing, China). The overlapping sequences obtained from two internal amplification fragments of DNA were combined to produce the AcerOr2 DNA; similarly, the internal amplification segment of cDNA and the 3′, 5′ RACE products were combined to produce the AcerOr2 mRNA Homology searches were conducted on the NCBI platform ( www.ncbi.nlm.nih.gov). Alignments of multiple sequences were carried out using ClustalW (Thompson et al. 1994). The gene phylogenetic tree was built on Mega 4.0 software ( www.megasoftware.net) according to neighbor-joining algorithms (Tamura et al. 2007).

Developmental expression by real-time quantitative PCR (qRT-PCR)

The total RNA of worker bees, larvae (2, 4, and 6 days old), pupae (5 and 10 days old), and adults (1, 5, 10, 15, 20, 25, 30, 35, and 40 days old) for expression profiling were extracted. The corresponding partial cDNA sequences were amplified with the primers designed on the complete sequence of AcerOr2 (F: 5′ GGATCAGAGGAGGCCAAAAC- 3′, R: 5′ - CCAACACCGAAGCAAAGAGA- 3′) RPS18 was used as a housekeeping gene based on A mellifera RPS18 (Scharlaken et al. 2008) (F: 5‘ GATTCCCGATTGGTTTTTGA- 3′; R: 5′ - CCCAATAATGACGCAAACCT- 3′). qRT-PCR was run on M×3000P real-time PCR system (Stratagene,  www.stratagene.com) using the SYBR Premix Ex Taq kit (Takara). All samples were tested in triplicate. The reactions were incubated in a 96-well plate at 95° C for 20 sec, followed by 45 cycles at 95° C for 15 sec and at 60° C for 20 sec. A dissociation curve was created with the thermal profile at 95° C for 30 sec, 60° C for 30 sec, and 95° C for 30 sec. The 2^Ct method was used to measure the relative expression levels of the samples (Livak andSchittgen 2001).

mRNA in situ hybridization

Three digoxigenin-labelled RNA antisense oligonucleotide probes were synthesized by Boster ( www.bosterbio.com) according to the cDNA full-length of AcerOr2, which was acquired in the study. The sequence of the antisense probes was as follows:

Antennae from 1- to 3-day-old adult workers were dissected, embedded in Tissue-Tec OCT Compound (Sakura,  www.sakura.eu). Cryosections (8 µm) were prepared at -22° C and mounted on poly-L-lysine treated slides. Samples were air-dried for 5 min before being fixed in 4% paraformaldehyde/O. 1M phosphate-buffered saline (PBS) with 0.1% diethyl pyrocarbonate. Then, the slides were washed 3 times with double distilled water and airdry ed for about 30 min. The hybridization protocol was performed according to the RISH kit instructions (Boster). In the process, slides were prehybridized for 3 hr. Then, hybridization solution was added to the tissue section, and each slide was covered with a coverslip. Slides were hybridized for 16 hr with the digoxigenin-labeled antisense probes at 42° C in a humid box with 20% glycerol (double distilled water was substituted for the antisense probes as a negative control). After hybridization, the coverslip was removed, and slides were washed twice in 2×SSC for 5 min at 37° C, and once in 0.5×SSC and 0.2×SSC for 15 min at 37° C respectively. Then, they were treated with blocking solution for 30 min at 37° C and washed 4 times in 1×PBS for 5 min. Slides were incubated in biotinylation mouse anti-digoxigenin for 1 hr at 37° C and then in Strept Avidin-Biotin Complex- alkaline phosphatase for 30 min at room temperature. After being washed 4 times in 1×PBS for 5 min, the hybridization signals were visualized using nitroblue tetrazolium and 5-brom-4-chlor-3-indolyl. Finally, the sections were viewed by using a light microscope (Olympus BX53,  www.olympusglobal.com) and were imaged using ImagePro Plus 7.0 software (Media Cybernetics,  www.mediacy.com).

Characterization and analysis of the partial DNA fragments

AcerOr2, a fragment of 1138 bp, was obtained by splicing the 2 internal specific overlapping PCR sequences. The fragment contained 3 exons and 2 introns, with 58.9% A+T nucleotides and 41.1% G+C nucleotides.

Alignment with the other 2 homologous DNA sequences (BLAST in NCBI) revealed that AcerOr2 exhibits higher identity with Amel0r2 (80.4%) than with BterOr2 (72.6%). Respectively, AmelOr2 and BterOr2 exhibit 96%/64.8% and 83%/62.2% similarity with the exons/introns of AcerOr2. The divergence was mainly attributed to the difference in length of the introns and the nucleotide variation. The alignment sequences and the ideograph of the 3 genes are shown in Figure 1.

Characterization and analysis of the fulllength cDNA

Using RT-PCR and RACE methods, identified the full-length cDNA sequence of AcerOR2 was identified (GenBank accession number: JN792581) (Figure 2). Sequence analysis showed that the open reading frame was 1437 bp long and encodes a protein comprising 478 amino acids with a molecular weight of 53.81 kDa. The 5′ and 3′ noncoding regions contained 116 bp and 210 bp, respectively. AcerOR2 was predicted to contain 7 TM topology structures of ORs (determined by TMHMM 2.0, Krogh et al. 2001).

The alignment of amino acid sequence of AcerOr2 with DmelOr83b and other orthologues of Hymenoptera (Figure 3) indicated that AcerOr2 shared high levels of conservation with other Hymenoptera Orco genes (> 74% identity). It showed a considerable similarity to AmelOr2 (99.8% identity) and a relatively low similarity to DmelOr83b (64.9%). Isogeny in Hymenoptera was similar with that in Lepidoptera (Xiu et al. 2010). The alignment also revealed a highly conserved region in the C-terminus, particularly between TMs VI and VII, which is remarkably identical in all of the species. To investigate and confirm the evolutionary relationships among these alignment species, a phylogenetic tree was constructed using the neighbor-joining method (Figure 4). The tree showed that the selected Hymenoptera insects were grouped into 4 main clusters or families, namely Apidae, Formicidae, Braconidae, and Chalcididae.

Developmental expression pattern in worker bees

The expression pattern of AcerOr2 transcripts was determined by qRT-PCR on different developmental stages in worker bees (Figure 5). qRT-PCR results showed that AcerOr2 transcripts were expressed broadly in adults. The expressions were expressed only slightly in larvae, and as the developmental stages progressed, the expression level increased. Notably, the expression reached the maximum level on the day prior to eclosion, revealing that the ability for olfactory recognition enhanced sharply. Furthermore, there was a relatively high level of expression on the first day after eclosion.

Location analysis in antennae of worker bees

There are several types of chemosensilla in the antennae of honeybee (Esslen and Kaissling 1976), and the sensilla placodea and sensilla trichoidea may be associated with olfactory sensation (Sliber and Sekhon 1961; Kaissling and Renner 1968). In our study, the expression pattern of AcerOr2 was investigated in workers' antennae. The positive signals were distributed in most sensilla placodea and on the basal region of the antennal cuticle (Figure 6). The expression location of the mRNA transcripts was similar to that found in AmelOr2 (Krieger et al.2003). No signal was detected in the negative control section.